Note
EdX does not support this tool.
The gene explorer (GeneX), from the biology department at UMB, simulates the transcription, splicing, processing, and translation of a small hypothetical eukaryotic gene. GeneX allows learners to make specific mutations in a gene sequence, and it then calculates and displays the effects of the mutations on the mRNA and protein.
Specifically, the gene explorer does the following:
For more information about the gene explorer, see The Gene Explorer.
<problem>
<p>Make a single base pair substitution mutation in the gene below that results in a protein that is longer than the protein produced by the original gene. When you are satisfied with your change and its effect, click the <b>SUBMIT</b> button.</p>
<p>Note that a "single base pair substitution mutation" is when a single base is changed to another base; for example, changing the A at position 80 to a T. Deletions and insertions are not allowed.</p>
<script type="loncapa/python">
def genex_grader(expect,ans):
if ans=="CORRECT": return True
import json
ans=json.loads(ans)
return ans["genex_answer"]=="CORRECT"
</script>
<customresponse cfn="genex_grader">
<editageneinput width="818" height="1000" dna_sequence="TAAGGCTATAACCGAGATTGATGCCTTGTGCGATAAGGTGTGTCCCCCCCCAAAGTGTCGGATGTCGAGTGCGCGTGCAAAAAAAAACAAAGGCGAGGACCTTAAGAAGGTGTGAGGGGGCGCTCGAT" genex_dna_sequence="TAAGGCTATAACCGAGATTGATGCCTTGTGCGATAAGGTGTGTCCCCCCCCAAAGTGTCGGATGTCGAGTGCGCGTGCAAAAAAAAACAAAGGCGAGGACCTTAAGAAGGTGTGAGGGGGCGCTCGAT" genex_problem_number="2"/>
</customresponse>
</problem>
In this code: